Resultados de investigación

Nanosized spinel-type ferrites have gained recognition as a unique class of engineered nanomaterials with promising applications, but their safety profiles remain insufficiently explored. Although iron (Fe), zinc (Zn), and manganese (Mn) are biologically relevant elements, the use of Zn- and Mn-containing ferrite nanoparticles (NPs) in biomedical contexts demands careful (geno)toxicity evaluation. In this study, three ferrite NPs – γFe2O3 (FeNPs), Zn0.7Fe2.3O4 (ZnNPs), and Mn0.4Fe2.6O4 (MnNPs) – synthesised through a microwave-assisted polyol route, functionalized with citric acid to improve colloidal stability, were evaluated for their potential (geno)toxic effects in an advanced in vitro 3D cell model, HepG2 spheroids. To assess the spatial distribution of the tested NPs within the 3D cellular architecture of HepG2 spheroids, TEM analysis was performed after 24 and 96 hours of exposure. HepG2 spheroids were exposed to each NP type at a concentration of 50 µg/mL. Following incubation, spheroids were collected, gently washed with phosphate-buffered saline (PBS, pH 7.4) to remove unbound NP, and fixed in 2 % glutaraldehyde in 0.1 M phosphate buffer (PB, pH 7.2) for 2 hours at room temperature, followed by incubation in 1.5 % glutaraldehyde in 0.05 M PB at 4°C overnight. Post-fixation was carried out with 1% osmium tetroxide for 1 hour at room temperature, followed by dehydration through a graded ethanol series (30%, 50%, 70%, 90%, and absolute ethanol) and infiltration with epoxy resin. For cross-sectional analysis, resin-embedded spheroids were polymerised at 60 °C for 48 hours, and ultrathin sections (~70 nm) were obtained using an ultramicrotome. Sections were collected on copper grids and stained with uranyl acetate (2% aqueous) and lead citrate to enhance contrast. Imaging was performed using a Tecnai T20 transmission electron microscope (Thermo Fisher Scientific, USA) operated at 200 kV. For each sample and time point, at least three spheroids were analysed. Additionally, in one selected spheroid, a systematic series of TEM images was acquired along a straight linear trajectory across the section, beginning at one external edge of the spheroid and progressing through consecutive adjacent fields until reaching the opposite border, and then the images were composed into a single frame., HE CutCancer project (101079113). H2020-MSCA NESTOR project (101007629). The Slovenian Research and Innovation Agency, Peer reviewed

Video S1. Interaction between pristine MPs and LPS, Microplastics (MPs), due to their poor degradability, can accumulate in the body following ingestion. Most studies evaluating MP safety use pristine particles or those aged for a short period, thus overlooking the long-term physicochemical changes that MPs undergo once they are trapped in tissues. In this study, we observed pronounced alterations in the surface properties of polystyrene MPs after one year of exposure to artificial body fluids, including increased surface roughness and hydrophilicity. These changes enhanced the adhesion of biomolecules, such as lipopolysaccharide (LPS), a typical pathogen-associated molecular pattern (PAMP). Biomechanical analysis confirmed strong interactions between aged MPs and LPS. Once phagocytosed by macrophages, LPS-loaded aged MPs caused phagolysosomal damage and pyroptosis through noncanonical caspase-11 inflammasome activation, which in turn amplified canonical caspase-1-dependent inflammation. Importantly, the inflammatory impact of aged MPs was further validated in vivo in a dextran sulfate sodium (DSS)-induced colitis model in which aged MPs aggravated disease severity. Collectively, these results identify aged MPs as “Trojan horses” with enhanced ability to transport harmful extracellular biomolecules like LPS into the cytoplasm, thereby reprogramming inflammasome signaling. This study highlights particulate stimuli, such as aged MPs, as a previously unrecognized bridge-linking PAMPs with danger-associated molecular patterns (DAMPs)., Peer reviewed

Nanosized spinel-type ferrites have gained recognition as a unique class of engineered nanomaterials with promising applications, but their safety profiles remain insufficiently explored. Although iron (Fe), zinc (Zn), and manganese (Mn) are biologically relevant elements, the use of Zn- and Mn-containing ferrite nanoparticles in biomedical contexts demands careful (geno)toxicity evaluation. In this study, three ferrite nanoparticles – γFe2O3 (FeNPs), Zn0.7Fe2.3O4 (ZnNPs), and Mn0.4Fe2.6O4 (MnNPs) – synthesised through a microwave-assisted polyol route, functionalized with citric acid to improve colloidal stability, were evaluated for their potential (geno)toxic effects in an advanced in vitro 3D cell model, HepG2 spheroids. DNA damage induction was studied using the alkaline comet assay. After 24 and 96 hours of exposure, spheroids were dissociated into a single-cell suspension by collagenase treatment. Each spheroid was incubated in 0.25% trypsin–EDTA for 3 minutes and then gently dissociated into a single-cell suspension using cut pipette tips. After this the comet assay was conducted under conditions described in the Supplement material (Table 1). The cell suspension was combined with 1% low-melting-point (LMP) agarose and layered onto fully frosted slides pre-coated with 1% normal-melting-point (NMP) agarose. Slides were lysed, the nucleoids unwound and electrophoresis preformed, followed by neutralisation of the gells., Table 1: Comet assay conditions. For comet scoring, gells were stained using the GelRed nucleic acid stain (Biotium, USA) according to the manufacturer's instructions. Analysis and scoring were performed using a fluorescent microscope and Comet Assay IV software (Instem, Philadelphia, USA). A positive (30 and 5 µM benzo[a]pyrene; BaP for 24 and 96 hours, respectively) control was included. Each experiment was conducted independently three times, analysing 50 nuclei per experimental point from a poled sample of 3-4 spheroids. The datasets represent the exported analysis performed in Comet Assay IV., NESTOR - Nanomaterials for Enzymatic Control of Oxidative Stress Toxicity and Free Radical Generation 101007629. European Commission CutCancer - TWINNING FOR EXCELLENCE TO STRATEGICALLY ADVANCE RESEARCH IN CARCINOGENESIS AND CANCER 101079113. The Slovenian Research and Innovation Agency, Peer reviewed

Nanosized spinel-type ferrites have gained recognition as a unique class of engineered nanomaterials with promising applications, but their safety profiles remain insufficiently explored. Although iron (Fe), zinc (Zn), and manganese (Mn) are biologically relevant elements, the use of Zn- and Mn-containing ferrite nanoparticles in biomedical contexts demands careful (geno)toxicity evaluation. In this study, three ferrite nanoparticles – γFe2O3 (FeNPs), Zn0.7Fe2.3O4 (ZnNPs), and Mn0.4Fe2.6O4 (MnNPs) – synthesised through a microwave-assisted polyol route, functionalized with citric acid to improve colloidal stability, were evaluated for their potential (geno)toxic effects in an advanced in vitro 3D cell model, HepG2 spheroids. Cellular stress responses upon exposure to the particle were assessed using toxicogenomic analysis.This approach allows the identification of early molecular events that may precede overt toxicity, supporting a mechanistic understanding of adverse outcomes and facilitating the development of predictive biomarkers for hazard assessment. In the present study, the expression of selected DNA damage-responsive genes (TP53, MDM2, GADD45a, CDKN1A, OGG1, and JUNB), apoptosis-related genes (BCL2 and BAX) and oxidative stress response genes (SOD1, CAT, GPX1, GCLC, and GSR) was evaluated. The expression of the selected genes after exposure to the tested nanoparticles was analysed by qPCR primer assays (Applied Biosystems, USA) and One 48.48 Dynamic Array IFC for Gene Expression (Fluidigm, USA). After 24 and 96 hours of exposure, the spheroids were collected, and total RNA was isolated using the RNeasy Mini Kit from Qiagen (Qiagen, Germany) according to the manufacturer's instructions. 10 µg/mL etoposide served as athe positive control for the toxicogenomic analysis. RNA concentration and purity were assessed using a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific) by measuring absorbance at 260/280 nm and gele efectrophoresis (Figure 1). Reverse transcription of 1 µg total RNA per sample was performed with the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, MA, USA) on a BIO-RAD T100 thermal cycler under conditions listed in Table 3. For preamplification, 4 µL of each of the 24 selected TaqMan assays (SM2) were pooled into a primer mix. The reaction mixture was prepared using TATAA PreAmp GrandMasterMix (Tataa Biocenter, Sweden), the primer pool, and nuclease-free water, following manufacturer instructions. Negative controls (NTC for preamplification and NTCq for qPCR) were included. Each reaction contained 8 µL of mix and 2 µL of 5× diluted cDNA, processed in a 96-deep well plate, sealed, vortexed, and centrifuged (1000 g, 1 min). Preamplification was carried out on a BIO-RAD T100 thermal cycler under conditions in Table 4. Gene expression analysis used TaqMan Universal PCR Master Mix and TaqMan Gene Expression Assays (Table 6). Preamplified samples were diluted 10× with nuclease-free water. Assays were prepared by mixing equal volumes (6 µL) of each assay with Fluidigm Assay Loading Reagent Kit – 10IFCS. The reaction premix combined DNA Sample Loading Reagent and Fast Probe Master Mix (Biotium/Roche) and was added to each diluted cDNA sample. qPCR was performed on 48.48 Dynamic Array™ IFC chips using the Fluidigm BioMark™ HD System under conditions in Table 5. Data were analysed with Fluidigm Gene Expression Analysis Software and quantGenious. Fold changes >1.5 or <0.66 were considered biologically relevant. Statistical significance between NP-exposed cells and solvent controls was assessed using ANOVA and Dunnett’s test in GraphPad Prism v9 (GraphPad Software, CA, USA)., NESTOR - Nanomaterials for Enzymatic Control of Oxidative Stress Toxicity and Free Radical Generation 101007629. European Commission CutCancer - TWINNING FOR EXCELLENCE TO STRATEGICALLY ADVANCE RESEARCH IN CARCINOGENESIS AND CANCER 101079113. The Slovenian Research and Innovation Agency., Peer reviewed

Under a Creative Commons BY - NC 4.0 license.-- Material and methods: Cell lines culture, genetic modifications, and drug treatment. The MARIMO (Acute myeloid leukemia), HEL (Erythroleukaemia cells homozygous for JAK2 V617F mutation), K562 (Chronic myelogenous leukemia, BCR-Abl+), and THP-1 (Acute monocytic leukemia, JAK2 wt) cell lines were cultured in RPMI medium (Sigma-Aldrich). The Steffen Koschmieder laboratory kindly provided the MARIMO cell line after an MTA agreement with the Yuichi Ishikawa laboratory. HEK293T, A549, HepG2, PANC-1, PC-3, MDA-MB-231, and NHCF-v cell lines were cultured in DMEM (Sigma-Aldrich). Mediums were supplemented with 10% fetal bovine serum (FBS, Capricorn Scientific) and 1% penicillin/streptomycin (Pen/Strep, Sigma-Aldrich). HEL, K562, and THP-1 tumor cell lines were genetically modified to express ZsGreen-FireFly Luciferase (ZsGreen-FFLuc) and mutated calreticulin (mCALR) using lentiviral particles, obtained by co-transfecting HEK293T cells with the psPAX2 (Addgene #12260), the pMD2.G plasmids (Addgene #12259), and the lentiviral interest plasmid (pCCL1 Luc-T2A-ZsGreen and pCCL1 mCALR-T2A-RFP), by using PEI (Sigma-Aldrich). The mCALR sequence identified in the MARIMO cell line (del61), resembling a type 1-like mutation, was used to transduce HEL, K562, and THP-1 cell lines. All resulting cell lines expressed luciferase, ZsGreen (wt), and mCALR-expressing cells (mCALR+) co-expressed RFP protein. Fluorescence-activated cell sorting was used to isolate modified cell populations based on fluorescent protein expression, and mCALR expression was validated by flow cytometry and immunoblotting. Proliferation was evaluated between wild-type and mCAR+ derivative cell lines by Incucyte (Supplementary Figure 2). To knock out mCALR in MARIMO cells, a lentiviral CRISPR/Cas9 system was employed using the lentiCRISPRv2 (Addgene #52961) and lentiGuide-Puro (Addgene #52963) plasmids. A specific single guide RNA (sgRNA) targeting the mCALR was designed following the system requirements and cloned into the BsmBI site of the lentiCRISPRv2 vector following the protocol by Shalem et al. 1. The oligo sequences used were: (oligo 1: CACCGACGAGGAGCAGAGGATGATG, oligo 2:AAACCATCATCCTCTGCTCCTCGTC, Life Technologies). Loss of mutant CALR expression was confirmed by immunoblotting (see below). For venetoclax treatment, the IC50 was determined for each cell line, and a dose below the calculated IC50 was selected for subsequent experiments (Supplementary Figure 15). hiPSC differentiation into cardiomyocytes (hiPSC-CMs) Human induced pluripotent stem cells (hiPSCs; IPSC0028, Sigma-Aldrich) were differentiated into cardiomyocytes. Briefly, hiPSCs were seeded on Matrigel-coated plates (Corning) at a density of 1.5 × 10⁵ cells/cm² in Essential 8 (E8) medium (Gibco). After 48 h, differentiation was induced using RPMI medium (Biowest) supplemented with B27 minus insulin (Gibco) and 9 μM CHIR99021 (Sigma-Aldrich) for 24 h, followed by 48 h in RPMI B27⁻. The medium was then replaced with a 1:1 mixture of conditioned and fresh RPMI B27⁻ containing 5 μM IWP2 (Labclinics) for 48 h, and subsequently with fresh RPMI B27⁻ for an additional 48 h. Cultures were then maintained in RPMI supplemented with B27 plus insulin (RPMI B27⁺) for 72 h. Cardiomyocytes were purified by 48 h incubation in glucose-free RPMI B27⁺ medium (Gibco) and passaged using TrypLE (Gibco). Cells were reseeded on Matrigel-coated plates in RPMI B27⁺ supplemented with 10 μM Y-27632 (Stem Cell Technologies) and 10% KnockOut serum (Gibco). After 24 h, medium was replaced with RPMI B27⁺ containing 2 μM CHIR99021 (expansion medium), refreshed every 48–72 h. Cells were expanded for up to four passages before use. To monitor hiPSC-CM purity, cells were analyzed by flow cytometry after each passage using cardiac Troponin T (cTnT) as a marker. Cells were fixed with 2% paraformaldehyde for 15 min at 4 °C, permeabilized and blocked with 0.1% saponin (MilliporeSigma) and 10% donkey serum (Sigma-Aldrich), and stained with BV421-conjugated anti-cTnT antibody (clone 13-11, BD Biosciences, 1:200). Samples were washed with PBS and analyzed by flow cytometry. Differentiation batches with <80% cTnT⁺ cells were excluded from experiments. Selection of single-chain variable fragment (scFv) and CAR construct design The mutated calreticulin-specific single-chain variable fragments (scFvs) were derived from different previously described antibodies: mCALR-CAR0, from the 8B2-H6 antibody (WO 2016/087514); mCALR-CAR1, from the B3 antibody (WO 2020/175689 A1); mCALR-CAR2, from antibody clone 4; mCALR-CAR3, from antibody clone 74; and mCALR-CAR4, from antibody clone 132 (all from WO 2023/107994, Supplementary Figure 16). The construct included a human CD8 hinge, a human CD8 transmembrane domain, a human 4-1BB endodomain, and the ζ signaling endodomain of the T cell receptor complex (CD3ζ). Additionally, a T2A-enhanced green fluorescent protein (ZsGreen) sequence was incorporated. The construct was synthesized commercially (GenScript) and cloned into a pCCL1 lentiviral backbone. An identical lentiviral vector expressing ZsGreen alone was used as a control (mock) where indicated., Lentiviral Particle Production and T-cell Transduction, Activation, and Expansion To produce viral supernatant, HEK293T cells were co-transfected with the CAR-encoding pCCL1 lentiviral plasmid, the RRE and Rev plasmids, and a plasmid containing the sequence for the VSV-G envelope (kindly provided by Pablo Menéndez’s laboratory). Plasmid transfection was carried out using PEI for 5 hours. Viral supernatants were collected at 48 and 72 hours posttransfection and ultracentrifuged (26000 rpm, 2.5 hours at 4°C, Sorvall WX+, Thermo Scientific). The concentrated supernatant was then titrated in HEK293T cells to determine viral titer for consistent infections. PBMCs were isolated from blood samples of HDs or MPN patients using Ficoll Paque Plus (Merk) gradient centrifugation (PI24/276). Primary human T cells were cultured in RPMI 1640 supplemented with 10% heat-inactivated FBS and 100 U/mL penicillin/streptomycin at 37°C in a 5% CO₂ incubator. T cells were activated using plate-bound anti-CD3 (OKT3) and anti-CD28 (BD Biosciences). After 24 hours, human IL-7 and IL-15 (Miltenyi Biotec) were added at a final concentration of 10 ng/mL. The next day, T cells were seeded into a new plate and transduced with lentiviral CAR vectors at a multiplicity of infection of 30. Proper CAR cell generation was confirmed by eGFP expression and CAR surface expression through extracellular labeling of the scFv using a Biotin-AffiniPure F(ab’)2 Fragment Goat Anti-Mouse IgG (H+L) or Biotin- AffiniPure F(ab’)₂ Fragment Goat Anti-Human IgG (H+L) (Jackson ImmunoResearch Laboratories) followed by incubation with Streptavidin-PE (Miltenyi Biotech) and analyzed by flow cytometry. In Vitro Cytotoxicity Assays and Cytokine Release Determination T cells expressing different CAR-T constructs were co-cultured with target cells at the indicated E:T ratios for 24 to 48 hours to evaluate cytotoxicity. Wells containing only target cells served as controls for normalization. Comparisons were made between mCALR⁺ target cells co-cultured with CAR-transduced T cells and appropriate reference groups, depending on the experimental setup: against mCALR⁻ target cells co-cultured with CAR-T cells or against mCALR+ cells cocultured with non-transduced T cells. Experiments were conducted with a normalized CAR expression level of 35% to compare the different CAR constructs. Cytotoxicity was assessed using both Incucyte-based live-cell imaging and a luciferase-based viability assay. For the Incucyte assays, co-cultures were imaged every 6 hours for up to 48 hours using the Incucyte Live-Cell Analysis System (Sartorius). Red fluorescence intensity was used to quantify target cell survival. Viability was calculated as the percentage of the red fluorescence area relative to control wells at each time point, using the following formula: Viability (%) = (Orange fluorescence area of test wells at t / t₀) / (Orange fluorescence area of control wells at t / t₀) × 100, with analysis performed using Incucyte Analysis Software. In the luciferase-based assay, luciferase activity was measured at 24 and 48 hours post co-culture using D-luciferin (BioVision), and luminescence was recorded with a BioTek Microplate Reader (Agilent). Cell viability was calculated based on the percentage of luminescence relative to control wells using the formula: Viability (%) = (Luminescence of test wells / Luminescence of control wells) × 100. The production of the proinflammatory cytokine interferon-γ (IFN-γ) was measured in cytotoxicity assay supernatants using an enzyme-linked immunosorbent assay (ELISA) from BD Biosciences. Additionally, the multiplex immunoassay quantified TNFα, IL6, IL10, CXCL10, MIP1A/B, IL2, IL13, and IL5 using a customized multiplex immunoassay from R&D Systems, following the manufacturer’s instructions. Flow cytometry Samples were acquired using a MACSQuant® 10 Analyzer Flow Cytometer, a MACSQuant® VYB Flow Cytometer (Miltenyi Biotec), or a BD FACSDiscover™ S8 Cell Sorter (BD Biosciences). For surface staining, cells were resuspended in PBS containing 5% FCS and incubated with the appropriate antibody cocktails and Fcγ Block Reagent (BD Biosciences) for 30 minutes at 4 ºC in the dark. Cells were then washed twice with PBS plus 5% FCS. For intracellular staining, following surface staining, cells were fixed and permeabilized using the FoxP3 Transcription Factor Buffer Kit (Miltenyi Biotec) according to the manufacturer’s protocol, and then incubated with intracellular antibodies for 30 minutes at 4 ºC in the dark. The cell surface expression of mutated calreticulin was detected using an anti-human mutated calreticulin antibody (CAL2 clone, Dianova), followed by an Alexa Fluor-633 secondary antibody (ThermoFisher). All the antibodies used are presented in Supplementary Table 4. The immunophenotyping of healthy donor PBMCs, patient PBMCs, and CD34+ progenitor cells was analyzed using Kaluza Software (Beckman Coulter). The hCD3 phenotyping samples from mice were analyzed using FlowJo™ Software. First, dimensionality reduction was performed using t-SNE. Subsequently, the FlowSOM algorithm was applied to the t-SNE data to conduct unsupervised clustering, enabling the identification of distinct cellular subsets based on phenotypic profiles. Western blot analysis Whole-cell extracts were prepared by lysing cells for 15 min on ice in RIPA lysis buffer (Sigma-Aldrich) supplemented with protease and phosphatase cocktail inhibitors (Roche). Protein concentration in cell lysates was quantified by Bradford (BioRad) using a BioTek Microplate Reader. Cell culture supernatants were centrifuged using a 50 kDa Amicon filter (Sigma-Aldrich) to concentrate mCALR. Whole-cell lysates and cell culture supernatants were separated through SDS-polyacrylamide gels and transferred to a nitrocellulose membrane (BioRad). Membranes were blocked with 5% milk powder in 0.1% Tween 20 (Sigma-Aldrich) in PBS (PBS-T) for 1 h at RT, followed by incubation with primary antibodies diluted in 2.5% milk PBS-T. Western Blotting Luminol Reagent (Thermoscience) was used to detect protein expression with light-sensitive films (Phenix Research). The following antibodies were used: Anti-mCALR (1:500, Dianova), anti-Bcl-2 (1:250, SantaCruz), anti-Bcl-xL (1:1000, CellSignaling) and anti-GAPDH (1:1000, SantaCruz). Xenograft in vivo model. Nonobese diabetic B-NDG mice (female, 5-week-old, Inotiv) were housed in sterile facilities for immunosuppressed animals at the Center for Biomedical Research of Aragon (CIBA). Animal protocols were approved by the University of Zaragoza’s Advisory Ethics Commission for Animal Research (code PI48/23). Mice were IV transplanted with 3×105 Luc/ZsGreen–expressing HEL mCALR+ cells or MARIMO cell line. Two days later, 5×106 CART3-mCALR for eGFP-transfected (MOCK) T cells were i.v. infused. Tumour burden was followed by bioluminescence using the IVIS system (IVIS Lumina XRMS In Vivo Imaging System). To measure tumor burden, mice were injected intraperitoneally with 150 mg/kg of D-luciferin, and luminescence was monitored at the indicated time points. Signal intensity was quantified as total flux (photons/sec/cm²/sr) using Living Image software (PerkinElmer). Mice were regularly examined for weight loss, signs of stress, or the development of hind limb paralysis and euthanized according to preset criteria. Peripheral blood was collected weekly from the submandibular vein and samples were stained for flow cytometry to assess tumor burden (hCD33⁺GFP⁺/total cells) and the human T cells (hCD45⁺hCD3⁺/total cells) and CART3-mCALR cells (hCD45⁺ hCD3⁺ GFP⁺/total cells) persistence with total cells defined as the sum of hCD45⁺ and mCD45⁺ cells in each sample (Antibody information in supplementary Table 4). Red blood cells were lysed with ACK buffer (ThermoFisher). Similarly, spleen, blood, and bone marrow at euthanization were analysed by flow cytometry. Additionally, ex vivo bioluminescence imaging was performed on harvested mouse organs using the IVIS system. For survival analysis, animals were monitored daily and euthanized upon reaching predefined humane endpoints. CAR-treated mice were sacrificed seven days after the death of the last control animal, corresponding to approximately 25% longer survival, as established in the experimental design. At the time of euthanasia, spleen, liver, bone marrow, and tumor tissues were collected for the analysis of T-cell migration and tumor burden. In cases where a mouse in the CAR-treated group died before the planned endpoint, the euthanasia of the remaining mice was postponed by an equivalent period (25% of the control group survival) counted from the day of that death. RNA sequencing and data analysis. For bulk RNA-Seq analysis, patient-derived primary CD34+ cells were enriched, as previously indicated. Total RNA was extracted using TRIzol™ Reagent (Invitrogen). Briefly, samples were lysed in TRIzol, mixed with chloroform (PanReac), and centrifuged to separate phases. The aqueous phase was collected, RNA was precipitated with isopropanol (PanReac), washed with 75% ethanol, and resuspended in RNase-free water (Merk). Additional patient data is given in Supplemental Table 3. Total RNA sequencing was performed by CeGaT (Germany) using the WTS Classic service. Briefly, rRNA was depleted, total RNA was analyzed, libraries were prepared, and sequencing was conducted using Illumina sequencing platforms (Read length: 2 x 100 bp, Output: 6 M clusters (10 Gb) per sample). FASTQ files were preprocessed to filter by read length and sequence quality (minimum length of 50 bp) and to exclude reads with excessive ambiguous bases (>15% Ns). This filtering was performed using the Prinseq tool. Control samples correspond to SRR30220813–SRR30220816 from the SRP526030 study. Reads were mapped to the human reference genome (GRCh38.p14 primary assembly) using HISAT2 v2.2.1. Alignment files in SAM format were converted to BAM format using SAMtools v1.21 . Transcript assembly was performed with StringTie v2.2.2, using the GRCh38.113 GTF annotation file from Ensembl. Differential expression analysis was carried out using DESeq2, edgeR, and voom. For single-cell RNA sequencing, cryopreserved cell suspensions were thawed, washed, and resuspended in RPMI 1640 medium supplemented with 10% fetal calf serum (FCS), following the guidelines from 10x Genomics (CG000447—Handbook Cell Thawing Protocols for Singlecell Assays, Rev. B). Cell viability and counts were assessed using acridine range/propidium iodide staining and an automated cell counter (Cellaca MX, Cenibra GmbH, Germany). Singlecell suspensions were then loaded onto a Chromium GEM-X Single Cell 3′ chip (10xGenomics), targeting 20,000 cells per sample, and processed using the Chromium Controller with the GEM-X Universal 3′ Gene Expression v4 kit (10x Genomics) according to the manufacturer’s instructions. The resulting libraries were sequenced on a NovaSeq X Plus (Illumina) using a 25B flow cell, achieving an average depth of approximately 40,000 reads per cell. Sequencing data were demultiplexed and processed with Cell Ranger (v9.0.1) using the GRCh38-2024-A reference genome. 15,782 cells were recovered for sample 1 (MARIMO cell line used for infusion) and 13,051 cells for sample 2 (pooled spleen residual tumor cells), with median gene counts of 3,248 and 2,042 per cell, respectively. Filtered feature-barcode matrices were subsequently analyzed in Seurat (v5.1.0). Cells were retained if they expressed between 600 and 6,000 genes per cell and had less than 20% mitochondrial gene content. Batch correction was performed using SCTransform. After quality control and filtering, the final high-quality libraries contained 13,861 (sample 1) and 9,661 (sample 2) cells, each expressing more than 2,000 genes per cell. Principal component analysis (PCA) and Uniform Manifold Approximation and Projection (UMAP) were computed from the top 30 principal components. Clustering was performed using the Louvain algorithm at a resolution of 0.5, and transcriptional clusters were identified using the FindAllMarkers function in Seurat. Cluster annotation was based on the top-ranked marker genes, and gene module scores were computed using the AddModuleScore function. Comparisons between clusters of interest were conducted using the FindMarkers function in Seurat (Wilcoxon rank-sum tests with Bonferroni correction), with the parameters logfc.threshold = 0, min.pct = 0, and min.diff.pct = −Inf to retain all detected features. Filtered differential expression results were subsequently refined using in-house scripts, applying a minimum adjusted p-value of 0.05 and a minimum log₂ fold change of 0.5., Supplementary Table 1. Kinetic binding parameters and functional activity of anti-mCALR antibody clones, as reported in the respective patents; Supplementary Table 2. Clinical characteristics of patients included in cytotoxicity assays; Supplementary Table 3. Clinical characteristics of patients included in the RNA-seq analysis; Supplementary Table 4. List of antibodies.--, Supplementary Figure 1. Surface expression of CART3-mCALR by human scFv labelling detected by flow cytometry in primary T cells; Supplementary Figure 2. Proliferation of wildtype (WT) and mutated Calreticulin (CALR mut) K562, HEL and THP-1 cell lines using IncuCyte live-cell imaging by confluency analysis; Supplementary Figure 3. CART3-mCALR induces higher cytokine secretion levels compared to other constructs, as measured by Luminex of supernatant of a cytotoxicity at 4:1 E:T ratio against K562 cell line; Supplementary Figure 4. CAR-T cell cytotoxicity against cell lines expressing distinct mCALR variants; Supplementary Figure 5. Real-time cytotoxicity assay monitored by IncuCyte confluence analysis in mCALR-negative cell lines and mCALR-positive controls; Supplementary Figure 6. Cytotoxicity of anti-mCALR CAR-T cells against primary cardiomyocytes, cardiac fibroblasts, and PBMCs; Supplementary Figure 7; Supplementary Figure 8; Supplementary Figure 9; Supplementary Figure 10; Supplementary Figure 11; Supplementary Figure 12; Supplementary Figure 13; Supplementary Figure 14; Supplementary Figure 15; Supplementary Figure 16. Sequences of CARs constructs indicating the source patent for each sequence., This work was funded by the Instituto de Salud Carlos III (ISCIII) through the Strategic Action in Health (AES), 2025 call, Health R&D Projects – Strategic Lines of Health Research (project/grant number: PI25/00236). AR-L is funded by a Ramón y Cajal contract (RYC2022-036627-I), financed by MCIN/AEI/10.13039/501100011033 and the European Social Fund (ESF) “Investing in your future” and ASPANOA. Grant PROY_B61_24 "proyectos de Investigación, desarrollo e innovación (I+D+i) en líneas prioritarias y de carácter multidisciplinar" funded by Gobierno de Aragón to AR-L and DSM. The Instituto de Salud Carlos III (ISCIII) through the Spanish Network of Advanced Therapies (RICORS/TERAV+), project RD24/0014/0015, and co-funded by the European Union (EU) to AR-L, JP, DSM and EMG. Work in the JP laboratory is funded by CIBERINFEC-ConsorcioCentro de Investigación Biomédica en Red- (CB21/13/00087), CERTERA andTERAV+ from Institutode Salud Carlos III, FEDER (Fondo Europeo de Desarrollo Regional),Gobierno deAragón (Group B29_23R, and LMP139_21), Grants PID2020-113963RBI00 andPID2024-157582OB-I00from MCIN/ AEI/10.13039/501100011033 and private social initiatives(FARO, AECC, Dona Médula, ASPANOA, and Carrera de la Mujer de Monzón No 101018587). Grant PID2022-136554OA-I00 funded by MICIU/AEI 10.13039/501100011033 and the European Regional Development Fund (ERDF)/EU to DSM. Predoctoral Grant for Ibero-Americas in Doctoral studies University of Zaragoza-Santander University (ACP), and Predoctoral Grant from AECC (CP). This work is part of a project that has received funding from the European Research Council (ICoMICS grant agreement No 101018587).--, Peer reviewed

Dataset associated with the analysis of the cultural macroevolution of arcade video games, including machine-level data, technological traits, and derived metrics used in the study, S. V. was supported by the grant PID2020-117822GB-I00, funded by the Ministerio de Ciencia, Innovación y Universidades (MICIU) / Agencia Estatal de Investigación (AEI) / 10.13039 / 501100011033., Peer reviewed

This study evaluated how the production system (free range vs. barn) influences the physical, compositional, and rheological properties of raw and grilled eggs. Free range eggs showed stronger correlations between external dimensions and internal composi-tion, suggesting potential for nondestructive grading, whereas barn eggs exhibited heavier shells but weaker morphometric–composition relationships. Haugh units differentiated production systems, and yolk redness was the only color parameter clearly associated with free range origin. Mechanical tests revealed that barn eggs had shells capable of ab-sorbing more energy during rupture. Rheological measurements showed matrix specific behaviors: in raw samples, albumen behaved as a weakly structured viscoelastic fluid, while yolk exhibited characteristics of a concentrated lipoprotein emulsion. Stress, fre-quency, and temperature sweeps demonstrated opposite effects of production system on both matrices: barn housing strengthened the albumen protein network, whereas free range conditions reinforced the yolk lipoprotein matrix. Yolk behavior fitted the weak gel model with excellent accuracy (R² ≈ 1), while albumen did not. Steady shear and three step tests confirmed pronounced shear thinning and thixotropic behavior in both matrices, with barn eggs showing higher viscosities but lower structural recovery. Ther-mal treatment reduced the strong rheological differences between raw albumen and yolk, yet production system effects persisted. All grilled samples behaved as weak gels, with barn egg whites forming stiffer networks and free range yolks generating more elastic, co-hesive, and energy absorbing gels. A trend toward higher MUFA levels was observed in raw free range yolks. Microscopy further clarified how production system shapes the structural and functional behavior of egg matrices., Peer reviewed

Under a Creative Commons BY 4.0 license., EXPERIMENTAL SECTION: 1. Materials and methods 1.1 Materials 1.2 Oxidation of biochar 1.3 Preparation of oBC/ODA via ball milling: Table S1. Experimental Conditions of the Ball Milling Experiments; Table S2. Elemental analysis of the functionalized Biochar 2. Characterization. 2.1. Elemental analysis (EA). 2.2. Thermogravimetric analysis (TGA). 2.3. UV-vis Spectroscopy. 2.4. Wide-angle X-ray diffraction (WAXD). 2.5. BET surface areas. 2.6. XPS 2.7. Infrared spectroscopy (FTIR). 2.8. Raman spectroscopy 2.9 Water contact angle XPS results: Figure S1. Survey spectra of pristine, oxidized, and functionalized biochars. Raman spectroscopy: Figure S2. Raman spectra of pristine, oxidized, and functionalized biochars; Table S3. Raman peaks positions. Relative stability in water: Figure S3. A) FTIR, of: a) BC/ODA, b) BC/ODA kept in water for 30 days, c)oBCBM/ODA, d) oBCBM/ODA kept in water for 30 days, e) ODA. Solid dots showing the wavenumbers related to ODA. Table S4. Elemental analysis of the functionalized Biochar before and after water treatment Coating procedure: Figure S4. Samples made by immersion with different numbers of layers. Figure S5 UV measurements in the spectral range 200–800 nm, in the neutral aqueous solution for a) oBCBM, b) Hemp fiber kept 5 days in H2O, c) Coated Hemp fiber- kept 5 days in H2O. Emulsion Adsorption Test: Table S5. Emulsion adsorption of Hemp and hexane-coated hemp fibers Water Desorption Test: Table S6. Water desorption test of hemp and hexane-coated hemp fibers, Authors acknowledge Prin 2022 PNRR, funded by the Italian Ministry of University and Research, ‘‘Developing Mechanochemical Technologies to Render Crop Protection Agrochemicals Greener (DEMETRA)’’ (contract number P202289FCM), “RITECA—Rivestimenti Innovativi per il settore Tessile Ecosostenibili e con Caratteristiche Antimicrobiche" (contract number PE00000004), and the use of instrumentation as well as the technical advice provided by Analysis and Characterization service at ICB-CSIC. C.D.S is grateful for the Juan de la Cierva (JdC) fellowship (Grant Number: JDC2022-048765-I) funded by MICIU/AEI /10.13039/501100011033 and by the European Union with NextGenerationEU/PRTR., This work was supported by RITECA—Rivestimenti Innovativi per il settore Tessile Ecosostenibili e con Caratteristiche Antimicrobiche" (contract number PE00000004) “MICS—Made in Italy Circolare e Sostenibile” Spoke 4 (PNRR MUR, Missione 4, componente 2, Investimento 1.3, finanziato dall’Unione Europea—NextGenerationEU)., Peer reviewed

Under a Creative Commons BY 4.0 license., Figure S1. Representative photographs of the mixtures obtained after the mechanochemical process for samples, from left to right, PA-P1, PA-P3, and PA-P6; Figure S2. TEM images of the whole PA-PX series: a) PA-P0, b) PA-P1, c) PA-P2, d) PA-P3, e) PA-P4, f) PA-P5, g) PA-P6 and h) PA-P7. Figure S3. (a) Differential, and (b) cumulative pore size distributions (PSDs) of all PA-PX samples. Table S1: Textural properties calculated from PSDs obtained by applying the 2D-NLDFT-HS to N2 and H2 adsorption-desorption isotherms. Figure S4. Raman spectra of PA-P1, PA-P3, PA-P4, PA-P5 and PA-P7 samples Table S2. ID/IG ratio obtained from Raman spectra. Table S3. Initial wt. % of Pluronic® F-127 and mass loss related to Pluronic® F-127 obtained from the TG results of the entire PA-PX series, including Pluronic® F-127 for comparison purposes. Percentage of Pluronic® F-127 eliminated from each sample, calculated from the relationship between mass loss and initial Pluronic® F-127 content. Figure S5. a) 31P and b) 13C solid-state MAS-NMR spectra of some PA-PX_mix samples before heat treatment. c) A zoom in on the 13C solid-state MAS-NMR spectra is also shown to better visualize the region 100-0 ppm. Figure S6. a) CP-MAS 31P NMR spectra of the entire PA-PX series. b) Comparison of CP-MAS and MAS-NMR 31P NMR spectra for sample PA-P7. Figure S7. High energy conformers for the PC1 and PO1 models, showing the energy relative to the lowest energy conformers displayed in Figure 6. Table S4. 31P-NMR chemical shifts calculated relative to H3PO4 for periodic models (Calc), obtained with the periodic DFT and the PBE functional; shifts for molecular analogues calculated with the same theoretical approach (Model) are provided and compared with experimental values (Ref) to validate the theoretical approach. Good agreement is obtained between Model and Ref (absolute differences less than 10 ppm).Figure S8. CV representation of PA-P6 material before and after HER. Table S5. Literature comparison performances of metal-free materials shown in Figure 5e towards the HER. Blue color means N-doped materials, green color means phosphorous doped materials, and the red one is our best material. Figure S9. Spin densities of the model structures.Figure S10. Free energy profiles for the Volmer-Tafel reaction mechanism. Note that the TS of H2 elimination lies at approximately the same energy for all systems under study, and to simplify the figure all energy levels have been represented by a single line., Crystal data, This study was partly supported by the French PIA project “Lorraine Université d’Excellence”, reference ANR-15-IDEX-04-LUE, and the TALiSMAN project funded by ERDF (2019-000214). SGD thanks the Ministerio de Universidades, the European Union and the University of Oviedo for their financial support (MU-21-UP2021-030 30267158). L. B. and D. D. acknowledge financial support by projects PID2022-138062NB-I00 and PRE2020-093504 from Ministerio de Ciencia e Innovación, Spain, and computational time from Red Española de Supercomputación, project QHS-2024-1-0031, and Consorci de Serveis Universitaris de Catalunya., Peer reviewed

This dataset provides measurements of Physalia physalis, Velella velella and Porpita porpita abundance on the coasts of the Canary Islands, Strait of Gibraltar and Spanish Mediterranean, conducted over 2022-2025., This dataset includes data collected from ICMAN-CSIC (Spain) between 2022 and 2025 that have been used to estimate the seasonality and inter-annual variability of Physalia physalis, Velella velella and Porpita porpita abundance in the coasts of the Canary Islands, Strait of Gibraltar and Spanish Mediterranean., This research was funded by the Spanish Ministry of Science, Innovation and Universities under the National R&D&I Plan PHYSALIA, PID2023-147159NB-C32, CSIC grant number 202330E57 “Estudio de los efectos motores climáticos de impacto sobre las dinámicas poblacionales de medusas mediterráneas”, CSIC (grant number 201730I072 "Forzamientos físicos en la proliferación costera de organismos gelatinosos”) and the Contract Agreement “Detección de medusas en el mar Balear y su relación con las condiciones ambientales: hacia el desarrollo de un sistema de predicción pre-operacional” among Govern des Illes Balears, SOCIB and CSIC (Disposición 15052 del BOE núm. 310 de 2020). The dataset is subject to a Creative Commons License Attribution-ShareAlike 4.0 International., Peer reviewed