Resultados de investigación

We selected 348 eDNA samples collected between 2018 and 2023 across the northwestern Mediterranean Sea, using either surface or bottom sampling. Each sample consisted of 30 L of seawater collected along a 2-km transect parallel to the coastline and filtered within 30 min using a peristaltic pump and a VigiDNA 0.2 μm cross-flow filtration capsule (SPYGEN). After filtration, residual water was removed from the capsule, which was then filled with 80 ml of CL1 conservation buffer (SPYGEN) and stored at room temperature until DNA extraction. Metabarcoding was conducted using the ‘teleo’ marker (forward primer: ACACCGCCCGTCACTCT; reverse primer: CTTCCGGTACACTTACCATG) (Valentini et al., 2016), following the protocol of Pichot et al. (2025). Using a well-resolved reference database (up to 87% coverage in the western Mediterranean Sea), most Amplicon Sequence Variants (ASVs) (unique, error-corrected DNA sequences used as species proxies in eDNA studies) were assigned to species level. Only species detections supported by at least 10 reads per PCR replicates and occurring in more than two PCR replicates over 12 per sample were retained to minimize the influence of spurious ASV potentially resulting from PCR or sequencing errors (Mathon et al., 2023)., For model predictions, eDNA samples were spatially aggregated (mean = 5 samples per site) within 73 sites defined by 10-km-radius buffers. Because the dataset includes detections of endangered species, such as the dusky grouper (Epinephelus marginatus; EN), only aggregated data are shared., Predicting marine species distribution and abundance is essential for effective conservation and management. Yet, it remains challenging in data-limited regions where traditional biodiversity surveys are logistically or financially constrained. Combining underwater visual census and eDNA fish sampling across the northwestern Mediterranean Sea, we tested a novel modelling framework that uses eDNA metabarcoding sequences to complement socio-environmental covariates in predicting species-specific local abundances. The eDNA-derived community proxies revealed ecological gradients complementary to visual census data, helping to distinguish sites dominated by coastal demersal fishes versus offshore predators, territorial reef fishes versus mobile dispersers, and benthic versus pelagic species. Using joint Species Distribution Models (jSDMs), within the Hierarchical Modelling of Species Communities (HMSC) framework, we compared the predictive performance of models based solely on socio-environmental covariates with those that additionally incorporated eDNA-based information. Including eDNA information significantly improved model fit for 16 out of 26 species, including the endangered dusky grouper (Epinephelus marginatus), and contributed to one-third of the explained variance in species local abundances on average. Synthesis and applications: This study demonstrates that integrating eDNA metabarcoding data into species distribution models can improve fish abundance predictions, especially for site-attached and reef-associated species. This approach provides a scalable and cost-effective tool for monitoring, impact assessment, spatial planning, and adaptive management of marine resources., Agence de l'eau Rhône Méditerranée Corse; European Union: 101060072, Horizon 2023 Research and Innovation Program, Peer reviewed

This dataset compiles the results of experiments carried out to explore the function of the FtsH protease in Lactococcus cremoris NZ9000. This protease is part of the lactococcal cell envelope stress (CES) response and previous work based on a ftsH deletion mutant reported that prophage-induced cell lysis was blocked. However, the specific molecular mechanisms defining the function of FtsH in the CES response remain unclear. The dataset comprises measurements that demonstrate the induction of the ftsH promoter under the stress imposed by bacitracin and the bacteriocin Lcn972, which were measured by promoter fusions to lacZ encoding the β-galactosidase enzyme gene in L. cremoris NZ9000 and in a CES-response deficient strain. This dataset also includes the complete output of variant analysis after sequencing the ftsH deletion mutant and comparison to the reference sequence (GenBank NC_017949.1) and the relative gene expression of tex, ythC and llnz_rs00910 in L. cremoris NZ9000 ΔftsH compared to the parental strain. Finally, the half-life of the proteins Tex, YthC and YthA in the parental and the mutant strain at different optical densities and the 2D-PAGE gel, where proteins with higher abundance in L. cremoris NZ9000 ΔftsH were detected, are also presented., grants PID2020-119697RB and PID2023-149852OB-I00 funded by MCIU/AEI/10.13039/501100011033 and FEDER/EU and Grant IDE/2024/000721 funded by AGENCIA SEKUENS (Gobierno de Asturias) and FEDER, EU awarded to B.M., 01_beta galactosidase activity 02_Genome sequencing 03_qRT-PCR 04_Half life 05_2D-PAGE, Peer reviewed

The zip-file contains files and R-code in a repository structured to perform the analyses in the paper. The data files in the zip-file are: field measurements of Red-necked nightjars, Caprimulgus ruficollis trapped and examined during the breeding seasons in 2011 to 2020, and individual-based data on positioning, activity and temperature of a subset of adult birds in 2016 to 2020. The data were used to investigate movement ecology, energetics and timing of annual life-cycle events of this population in relation to the lunar cycle. A detailed description of the data included in each dataset is found in the file ‘Metadata’. More information about the sampling procedures and collection of the data is available in the method and supplementary information of the study. The word document 'Multisensory data overview' show plots like Figure S2 in the supplementary materials for all dataloggers included in the study and provied a graphical overview of the data., Fundación Ramón Areces Grant ID: BEVP31A614; Swedish Research Council Sweden Grant ID: 2016-03625; Swedish Research Council Sweden Grant ID: 2020-03707; Swedish Research Council Sweden Grant ID: 2016–05342; Swedish Research Council Sweden Grant ID: 2022-03755; Linnaeus grant Grant ID: 349–2007-8690; Knut and Alice Wallenberg Foundation Sweden Grant ID: 2020.0096; NextGenerationEU/PRTR Grant ID: FPU19/05159; MICIU/AEI Grant ID: PID2023-153097NA-I00; MCIN/AEI Grant ID: RYC2021-033977-I, Peer reviewed

You can cite all versions by using the DOI 10.5281/zenodo.14609299. This DOI represents all versions, and will always resolve to the latest one., Peer reviewed

Audio and video recordings of Levaillant’s cuckoo and host fledglings reared by Blackcap Babblers (Turdoides reinwardtii) and Brown Babblers (Turdoides plebejus) in The Gambia were collected or curated by Clive R. Barlow between 2006 and 2025. Recordings of one Arrow-marked Babbler cuckoo and two host fledglings associated were provided by Derek Engelbrecht and Isaac Kilusu, some previously published (Derek Engelbrecht/Macaulay Library, Cornell Lab: ML617040028, ML617040040, ML617040041, ML617040048; Isaac Kilusu: XC819163, www.xeno-canto.org/819163; XC819164, www.xeno-canto.org/819164). We also included a unique recording of a Levaillant’s cuckoo fledgling begging and being fed by a Kurrichane Thrush (Turdus libonyana) in South Africa (Tony Archer, XC418749, www.xeno-canto.org/418749). No recordings of Kurrichane Thrush fledgling calls were available, but we included fledgling begging calls of the closely related African Thrush (Turdus pelios) recorded by CRB in The Gambia., This study investigated the presence of vocal mimicry in Levaillant’s cuckoos. The dataset contains acoustic variables automatically extracted with Avisoft SASLab (see “Steps to reproduce”), including call duration, and the mean and standard deviation of frequency bandwidth, entropy (energy dispersion across frequencies—low in pure tones, high in broadband calls), and the first and third frequency quartiles of the energy distribution (robust indicators of low and high frequency limits). Acoustic analyses and classification methods revealed that cuckoos reared by their primary host, the Brown Babbler (Turdoides plebejus), produced non food-transfer begging calls closely resembling those of host fledglings. By contrast, cuckoos raised by secondary hosts, including Blackcap Babblers (T. reinwardtii), showed little or no vocal similarity., [Steps to reproduce] All original audio files were annotated by the recordists to identify call types and behavioural context. A descriptive list of recordings is provided in the “List of recordings” Excel file. Vocalisations were analysed with Avisoft-SASLab Pro 5.3.2-36. For each recording, continuous annotated spectrograms were generated to identify callers, describe behavioural context, and classify vocal elements. Each element was defined by its distinctive amplitude envelope; where two successive elements formed a single vocalisation, they were analysed separately. Fledgling calls were classified as food-transfer calls, given during food delivery by adults, or non-transfer calls, given in the long intervals between feedings and often accompanied by wing-quivering or crouching. Cuckoos reared by Blackcap Babblers produced two distinct types of non-transfer calls that were categorized separately. To minimise background noise, a 0.6 kHz high-pass filter was applied. Spectrograms were generated with a 512-point FFT, FlatTop window, 100 % frame size, 50 % overlap, and a bandwidth of 162 Hz, yielding 11.6 ms temporal and 43 Hz frequency resolution. For each element, non-overlapping extraneous sounds were manually removed and amplitude thresholds adjusted to optimise signal-to-noise ratio. Nine acoustic parameters were automatically extracted for each element. As most vocalisations were harsh or multiband calls with low-frequency modulation, spectral measurements were based on the mean spectrum of the entire element as described in Avisoft-SASLab manual., Ministerio de Ciencia, Innovación y Universidades Spain Grant ID: PID2021-126673NB-100, Peer reviewed

You can cite all versions by using the DOI 10.5281/zenodo.14609299. This DOI represents all versions, and will always resolve to the latest one., Peer reviewed

This dataset provides a species-level phylogeny for 1,332 Mediterranean Lamiaceae species integrated with available ethnobotanical records. The phylogenetic framework consists of an ensemble of 500 trees reconstructed using the randtip R package, utilizing a megatree backbone. The ethnobotanical component is derived from a systematic review and meta-analysis of medicinal and food uses across 16 categories for the Mediterranean region. The repository provides the raw phylogenetic distribution, the raw ethnobotanical matrix, and R-based computational analyses. This pipeline enables the detection of non-random evolutionary signals in plant utility through optimized topology-based hot node analysis and distance-based metrics (MPD/MNTD jackknifing) to facilitate reproducible bioprospecting and lineage prioritization., 2023 FISDU 00141; Agencia Estatal de Investigación: FPU21/03564; Generalitat de Catalunya: 2021SGR00315; Generalitat de Catalunya: CLT051/2024; IEC-PR2023-16-PAT; R2024G, Peer reviewed

You can cite all versions by using the DOI 10.5281/zenodo.14609299. This DOI represents all versions, and will always resolve to the latest one., Peer reviewed

You can cite all versions by using the DOI 10.5281/zenodo.12807165. This DOI represents all versions, and will always resolve to the latest one., This post includes the pictures of all the holotypes of species of the genus Cazeresia Jolivet, Verma & Mille (Coleoptera: Chrysomelidae, Eumolpinae) described by Jesús Gómez-Zurita and Anabela Cardoso in the work "Systematics and evolution of the New Caledonian endemic genus Cazeresia (Coleoptera: Chrysomelidae, Eumolpinae)", published in volume 83 of Arthropod Systematics & Phylogeny., Peer reviewed

Final check list with all observations of wild bees in the Doñana protected area along with the code to process it and analyse it., Peer reviewed